After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TMEM246 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1212bp
Descrição de cDNA:Full length Clone DNA of Mus musculus transmembrane protein 246 with N terminal His tag.
Sinónimo de gene:AI835809, 2810432L12Rik, 9330170P15Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52552-ACG$225
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52552-ACR$225
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52552-ANG$225
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52552-ANR$225
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52552-CF$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52552-CH$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52552-CM$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52552-CY$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52552-G$75
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52552-NF$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52552-NH$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52552-NM$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52552-NY$195
Ratazanao TMEM246 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52552-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52552-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.