Encomenda rápida

Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato TMEM120B Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1020bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus transmembrane protein 120B with N terminal His tag.
    Sinónimo de gene:Tmem120b
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with TMEM120B qPCR primers for gene expression analysis, MP201834 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51961-ACG$225
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51961-ACR$225
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51961-ANG$225
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51961-ANR$225
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51961-CF$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51961-CH$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51961-CM$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51961-CY$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de expressão)MG51961-G$75
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51961-NF$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51961-NH$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51961-NM$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51961-NY$195
    Ratazanao TMEM120B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51961-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51961-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.