Encomenda rápida

Ratazanao TIMP-1/TIMP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TIMP1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:618bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tissue inhibitor of metalloproteinase 1 with C terminal Myc tag.
Sinónimo de gene:Clgi, Timp, TIMP-1, MGC7143, Timp1
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

TIMP metallopeptidase inhibitor 1, also known as TIMP-1/TIMP1, Collagenase inhibitor 16C8 fibroblast Erythroid-potentiating activity, TPA-S1TPA-induced proteinTissue inhibitor of metalloproteinases 1, is a natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. TIMP-1/TIMP1 is found in fetal and adult tissues. Highest levels are found in bone, lung, ovary and uterus. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 mediates erythropoiesis in vitro; but, unlike IL-3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors. In addition to its inhibitory role against most of the known MMPs, the protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this protein encoding gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This encoding gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 is Known to act on MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13 and MMP-16.

  • Hornebeck W (2004). Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growth and survival.. Pathol. Biol. 51 (10): 569-73.
  • Soini Y, et al. (2001) Expression of MMP2, MMP9, MT1-MMP, TIMP-1, and TIMP2 mRNA in valvular lesions of the heart. J Pathol. 194(2):225-31.
  • Wang X, et al. (1999) Analysis of coding sequences for tissue inhibitor of metalloproteinases 1 (TIMP-1) and 2 (TIMP2) in patients with aneurysms. Matrix Biol. 18(2):121-4.
  • Size / Price
    Catálogo: MG50342-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.