Encomenda rápida

Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato TFRC Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_011638.4
    Tamanho de cDNA:2292bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus transferrin receptor with N terminal His tag.
    Sinónimo de gene:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TFRC qPCR primers for gene expression analysis, MP200716 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50741-ACG$245
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50741-ACR$245
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50741-ANG$245
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50741-ANR$245
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50741-CF$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50741-CH$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50741-CM$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50741-CY$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50741-G$75
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50741-NF$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50741-NH$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50741-NM$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50741-NY$215
    Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50741-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

    Referências
  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Catálogo: MG50741-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"