Encomenda rápida

Text Size:AAA

Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TFRC Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2292bp
Descrição de cDNA:Full length Clone DNA of Mus musculus transferrin receptor with N terminal His tag.
Sinónimo de gene:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50741-ACG$245
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50741-ACR$245
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50741-ANG$245
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50741-ANR$245
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50741-CF$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50741-CH$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50741-CM$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50741-CY$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50741-G$75
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50741-NF$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50741-NH$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50741-NM$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50741-NY$215
Ratazanao TFRC/CD71 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50741-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Mouse transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • Size / Price
    Catálogo: MG50741-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.