Encomenda rápida

Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TCF25 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1878bp
Descrição de cDNA:Full length Clone DNA of Mus musculus transcription factor 25 (basic helix-loop-helix) with N terminal His tag.
Sinónimo de gene:Nulp1, mKIAA1049, D8Ertd325e, 1100001J13Rik, 1810041K11Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52531-ACG$245
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52531-ACR$245
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52531-ANG$245
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52531-ANR$245
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52531-CF$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52531-CH$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52531-CM$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52531-CY$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52531-G$75
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52531-NF$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52531-NH$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52531-NM$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52531-NY$215
Ratazanao TCF25 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52531-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52531-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.