Encomenda rápida

Text Size:AAA

Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TBC1D17 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1938bp
Descrição de cDNA:Full length Clone DNA of Mus musculus TBC1 domain family, member 17 with C terminal His tag.
Sinónimo de gene:BC017607
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51707-ACG$345
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51707-ACR$345
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51707-ANG$345
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51707-ANR$345
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51707-CF$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51707-CH$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51707-CM$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51707-CY$315
Mouse TBC1D17 Gene cDNA clone plasmidMG51707-G$75
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51707-NF$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51707-NH$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51707-NM$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51707-NY$315
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51707-U$115
Ratazanao TBC1D17 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51707-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51707-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.