Encomenda rápida

Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TAF11 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:AK050689.1
Tamanho de cDNA:636bp
Descrição de cDNA:Full length Clone DNA of Mus musculus TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor.
Sinónimo de gene:28kDa, TAF2I, PRO214, TAFII28, AI115401, AL024207, AW552398, 1110038O14Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51332-ACG$225
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51332-ACR$225
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51332-ANG$225
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51332-ANR$225
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51332-CF$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51332-CH$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51332-CM$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51332-CY$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51332-NF$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51332-NH$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51332-NM$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51332-NY$195
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51332-U$75
Ratazanao TAF11 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51332-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51332-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"