After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SMAD5 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1398bp
Descrição de cDNA:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 5 with N terminal His tag.
Sinónimo de gene:Madh5, Msmad5
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50728-ACG$225
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50728-ACR$225
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50728-ANG$225
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50728-ANR$225
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50728-CF$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50728-CH$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50728-CM$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50728-CY$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50728-G$75
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50728-G-Y$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50728-NF$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50728-NH$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50728-NM$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50728-NY$195
Ratazanao Smad5 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50728-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Catálogo: MG50728-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.