After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SMAD2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010754.4
Tamanho de cDNA:1404bp
Descrição de cDNA:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 2 with N terminal His tag.
Sinónimo de gene:Madh2, Madr2
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50727-ACG$225
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50727-ACR$225
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50727-ANG$225
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50727-ANR$225
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50727-CF$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50727-CH$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50727-CM$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50727-CY$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50727-G$75
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50727-NF$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50727-NH$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50727-NM$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50727-NY$195
Ratazanao Smad2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50727-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

Referências
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Size / Price
    Catálogo: MG50727-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"