After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SERPINB8 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_011459.3
Tamanho de cDNA:1425bp
Descrição de cDNA:Full length Clone DNA of Mus musculus serine (or cysteine) peptdiase inhibitor, clade B, member 8 with N terminal Myc tag.
Sinónimo de gene:CAP2, NK10, Spi8, CAP-2, ovalbumin, Serpinb8
Espécie:Mouse
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50215-ACG$225
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50215-ACR$225
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50215-ANG$225
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50215-ANR$225
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50215-CF$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50215-CH$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50215-CM$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50215-CY$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50215-M$75
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50215-NF$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50215-NH$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50215-NM$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50215-NY$195
Ratazanao SerpinB8 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50215-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

Referências
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Catálogo: MG50215-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"