SYNPR cDNA ORF Clone, Mouse, N-His tag

Cat: MG52529-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SYNPR Reagents

CRO Services

Product recommended


All SYNPR Reagents

SYNPR cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
798 bp
Description
Full length Clone DNA of Mouse synaptoporin with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SYNPR cDNA ORF Clone, Mouse, N-His tag Alternative Names

1500003F20Rik cDNA ORF Clone, Mouse;SPO cDNA ORF Clone, Mouse

SYNPR Background Information

Full Name
synaptoporin

SYNPR cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SYNPR cDNA ORF Clone in Cloning Vector, Cynomolgus CG90391-G
SYNPR cDNA ORF Clone, Cynomolgus, untagged CG90391-UT
SYNPR Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90391-ACGLN
SYNPR cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90391-ACG
SYNPR cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90391-ANG
SYNPR cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90391-ACR
SYNPR cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90391-ANR
SYNPR cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90391-CF
SYNPR cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90391-NF
SYNPR cDNA ORF Clone, Cynomolgus, C-His tag CG90391-CH
SYNPR cDNA ORF Clone, Cynomolgus, N-His tag CG90391-NH
SYNPR cDNA ORF Clone, Cynomolgus, C-HA tag CG90391-CY
SYNPR cDNA ORF Clone, Cynomolgus, N-HA tag CG90391-NY
SYNPR cDNA ORF Clone, Cynomolgus, C-Myc tag CG90391-CM
SYNPR cDNA ORF Clone, Cynomolgus, N-Myc tag CG90391-NM

SYNPR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SYNPR cDNA ORF Clone in Cloning Vector, Mouse MG52529-G
SYNPR cDNA ORF Clone, Mouse, untagged MG52529-UT
SYNPR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52529-ACGLN
SYNPR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52529-ACG
SYNPR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52529-ACR
SYNPR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52529-CF
SYNPR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52529-NF
SYNPR cDNA ORF Clone, Mouse, C-His tag MG52529-CH
SYNPR cDNA ORF Clone, Mouse, C-HA tag MG52529-CY
SYNPR cDNA ORF Clone, Mouse, N-HA tag MG52529-NY
SYNPR cDNA ORF Clone, Mouse, C-Myc tag MG52529-CM
SYNPR cDNA ORF Clone, Mouse, N-Myc tag MG52529-NM
SYNPR qPCR Primer Pairs, Mouse MP202402

SYNPR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SYNPR cDNA ORF Clone, Human, untagged HG23372-UT
info info
添加购物车成功! 添加购物车失败!