Encomenda rápida

Text Size:AAA

Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SRFBP1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1326bp
Descrição de cDNA:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Myc tag.
Sinónimo de gene:p49/STRAP, 2810036K01Rik
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51646-ACG$225
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51646-ACR$225
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51646-ANG$225
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51646-ANR$225
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51646-CF$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51646-CH$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51646-CM$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51646-CY$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de expressão)MG51646-G$75
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51646-NF$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51646-NH$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51646-NM$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51646-NY$195
Ratazanao SRFBP1 (p49/STRAP) clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51646-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Catálogo: MG51646-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.