Encomenda rápida

Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato SPAG9 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001025429.1
    Tamanho de cDNA:3507bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus sperm associated antigen 9 with N terminal His tag.
    Sinónimo de gene:JLP, Jip4, syd1, JSAP2, JSAP2a, AW552012, Mapk8ip4, 3110018C07Rik, 4733401I23Rik, 4831406C20Rik
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPAG9 qPCR primers for gene expression analysis, MP201840 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51967-ACG$375
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51967-ACR$375
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51967-ANG$375
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51967-ANR$375
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51967-CF$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51967-CH$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51967-CM$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51967-CY$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51967-G$75
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51967-NF$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51967-NH$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51967-NM$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51967-NY$345
    Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51967-UT$345
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51967-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"