After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SPAG9 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3507bp
Descrição de cDNA:Full length Clone DNA of Mus musculus sperm associated antigen 9 with N terminal His tag.
Sinónimo de gene:JLP, Jip4, syd1, JSAP2, JSAP2a, AW552012, Mapk8ip4, 3110018C07Rik, 4733401I23Rik, 4831406C20Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51967-ACG$375
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51967-ACR$375
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51967-ANG$375
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51967-ANR$375
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51967-CF$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51967-CH$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51967-CM$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51967-CY$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51967-G$75
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51967-NF$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51967-NH$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51967-NM$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51967-NY$345
Ratazanao SPAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51967-UT$345
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51967-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.