Encomenda rápida

Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato SNURF Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_033174.3
    Tamanho de cDNA:216bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus SNRPN upstream reading frame.
    Sinónimo de gene:Snrpn, 2410045I01Rik
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SNURF qPCR primers for gene expression analysis, MP201219 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51342-ACG$225
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51342-ACR$225
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51342-ANG$225
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51342-ANR$225
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51342-CF$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51342-CH$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51342-CM$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51342-CY$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51342-NF$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51342-NH$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51342-NM$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51342-NY$195
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de expressão)MG51342-U$75
    Ratazanao SNURF clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51342-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51342-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"