SMPDL3A cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

SMPDL3A cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1338 bp
Description
Full length Clone DNA of Mouse sphingomyelin phosphodiesterase, acid-like 3A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SMPDL3A cDNA ORF Clone, Mouse, C-His tag: Alternative Names

0610010C24Rik cDNA ORF Clone, Mouse; AI529588 cDNA ORF Clone, Mouse; ASM3A cDNA ORF Clone, Mouse; ASML3 cDNA ORF Clone, Mouse; ASML3A cDNA ORF Clone, Mouse

SMPDL3A Background Information

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.
Full Name
sphingomyelin phosphodiesterase, acid-like 3A
References
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后