Encomenda rápida

Ratazanao SMPD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SMPD1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1884bp
Descrição de cDNA:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase 1, acid lysosomal with N terminal His tag.
Sinónimo de gene:ASM, aSMase, A-SMase, Zn-SMase, Smpd1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.

Size / Price
Catálogo: MG50749-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.