Encomenda rápida

Ratazanao SLIT2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SLIT2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:4566bp
Descrição de cDNA:Full length Clone DNA of Mus musculus slit homolog 2 (Drosophila) with C terminal His tag.
Sinónimo de gene:Slil3, Drad-1, KIAA4141, mKIAA4141, E030015M03Rik, E130320P19Rik, Slit2
Local de restrição:KpnI + XbaI (6kb + 4.62kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 819 C/T, 1512 T/C, 1716 C/T, 2217 T/C and 3610 A/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SLIT2 Gene Plasmid Map
Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catálogo: MG50443-CH
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
  • Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.