Encomenda rápida

Text Size:AAA

Ratazanao CRACC/SLAM7/CD319 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SLAMF7 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1002bp
Descrição de cDNA:Full length Clone DNA of Mus musculus SLAM family member 7 with N terminal Myc tag.
Sinónimo de gene:19A, CS1, 19A24, CRACC, 4930560D03Rik, Slamf7
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao CRACC/SLAM7/CD319 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • Size / Price
    Catálogo: MG50201-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.