Encomenda rápida

Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato SERPINB6 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1137bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 6a with C terminal Myc tag.
    Sinónimo de gene:Spi3, AI876477, Serpinb6, ovalbumin, 4930482L21Rik, D330015H01Rik, Serpinb6a
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with SerpinB6 qPCR primers for gene expression analysis, MP200394 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50374-ACG$225
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50374-ACR$225
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50374-ANG$225
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50374-ANR$225
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50374-CF$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50374-CH$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50374-CM$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50374-CY$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50374-M$75
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50374-NF$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50374-NH$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50374-NM$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50374-NY$195
    Ratazanao SerpinB6 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50374-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

  • Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.
  • Strik MC. et al., 2004, Blood. 103: 2710-7.
  • Scott FL. et al., 2007, J Biochem. 142: 435-42.
  • Burkard TR. et al., 2011, BMC Syst Biol. 5:17.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.