Encomenda rápida

Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SERBP1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1224bp
Descrição de cDNA:Full length Clone DNA of Mus musculus serpine1 mRNA binding protein 1 with C terminal His tag.
Sinónimo de gene:Pairbp1, AL022786, 1200009K13Rik, 9330147J08Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52294-ACG$225
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52294-ACR$225
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52294-ANG$225
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52294-ANR$225
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52294-CF$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52294-CH$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52294-CM$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52294-CY$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52294-G$75
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52294-NF$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52294-NH$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52294-NM$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52294-NY$195
Ratazanao SERBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52294-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52294-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.