After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SEMA4A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_013658.3
Tamanho de cDNA:2283bp
Descrição de cDNA:Full length Clone DNA of Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, transcript variant 1 with C terminal Myc tag.
Sinónimo de gene:SemB, Semab, AI132332, Sema4a
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50330-ACG$245
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50330-ACR$245
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50330-CF$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50330-CH$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50330-CM$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50330-CY$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50330-M$75
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50330-NF$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50330-NH$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50330-NM$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50330-NY$215
Ratazanao Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50330-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Semaphorin-4A, also known as Semaphorin-B, SEMA4A, Sema B and SEMAB, is a single-pass type I  membrane protein which belongs to the semaphorin family. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Semaphorin-4A / SEMA4A contains one Ig-like C2-type (immunoglobulin-like) domain, one PSI domain and one Sema domain. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 (RP35) which leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in SEMA4A are also the cause of cone-rod dystrophy type 10 (CORD10) which are inherited retinal dystrophies belonging to the group of pigmentary retinopathies. CORDs are characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration.

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration.

Referências
  • Clark H.F., et al., 2003, Genome Res. 13: 2265-2270.
  • Ota T., et al., 2004,Nat. Genet. 36: 40-45.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Abid A., et al., 2006, J. Med. Genet. 43:378-381.
  • Size / Price
    Catálogo: MG50330-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"