After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Syndecan-4/SDC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SDC4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_011521.2
Tamanho de cDNA:597bp
Descrição de cDNA:Full length Clone DNA of Mus musculus syndecan 4 with N terminal His tag.
Sinónimo de gene:Synd4, AA959608, AW108331, ryudocan, syndecan-4, Sdc4
Espécie:Mouse
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Syndecan-4/SDC4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name
Fundo

SDC4 (Syndecan-4), also known as Syn4, is a transmembrane heparan sulfate proteoglycan that co-operates with integrins during cell-matrix interactions for the assembly of focal adhesions and actin stress fibers and in the phosphorylation of focal adhesion kinase (FAK) on Tyr397. Syndecan-4 plays roles in the formation of focal adhesions and stress fibers. The cytoplasmic domain of syndecan-4 interacts with a number of signalling and structural proteins, and both extracellular and cytoplasmic domains are necessary for regulated activation of associated transmembrane receptors. Syndecan-4/SDC4 is a heparan sulfate proteoglycan and works as a coreceptor for various growth factors. SDC4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cells (VSMCs) proliferation and vascular progenitor cells (VPCs) mobilization. Therefore, SDC4 may be a novel therapeutic target for preventing arterial restenosis after angioplasty.

Referências
  • Ikesue M, et al. (2011) Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol. 31(5): 1066-74.
  • Saoncella S, et al. (2004) Syndecan-4 regulates ATF-2 transcriptional activity in a Rac1-dependent manner. J Biol Chem. 279(45): 47172-6.
  • Bass MD, et al. (2002) Cytoplasmic interactions of syndecan-4 orchestrate adhesion receptor and growth factor receptor signalling. Biochem J. 368(Pt 1): 1-15.
  • Couchman JR, et al. (1999) Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci. 112 ( Pt 20): 3415-20.
  • Size / Price
    Catálogo: MG50726-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"