Encomenda rápida

Text Size:AAA

Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SCMH1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1995bp
Descrição de cDNA:Full length Clone DNA of Mus musculus sex comb on midleg homolog 1 with C terminal His tag.
Sinónimo de gene:Scml1, Scml3, AI315320, AI851618
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51716-ACG$245
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51716-ACR$245
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51716-ANG$245
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51716-ANR$245
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51716-CF$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51716-CH$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51716-CM$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51716-CY$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51716-G$75
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51716-NF$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51716-NH$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51716-NM$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51716-NY$215
Ratazanao SCMH1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51716-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51716-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.