Encomenda rápida

Text Size:AAA

Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse SCARB1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1530bp
Descrição de cDNA:Full length Clone DNA of Mus musculus scavenger receptor class B, member 1 with C terminal Myc tag.
Sinónimo de gene:CD36, Cla1, SRBI, Srb1, Cla-1, SR-B1, SR-BI, Cd36l1, mSR-BI, AI120173, D5Ertd460e, Scarb1
Local de restrição:KpnI + XbaI (6kb + 1.58kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SCARB1 Gene Plasmid Map
Mouse SCARB1 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50317-ACG$245
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50317-ACR$245
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50317-ANG$245
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50317-CF$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50317-CH$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50317-CM$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50317-CY$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50317-M$75
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50317-NF$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50317-NH$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50317-NM$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50317-NY$215
Ratazanao SR-BI/SCARB1/CD36L1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50317-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Catálogo: MG50317-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Mouse SCARB1 natural ORF mammalian expression plasmid, C-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.