Encomenda rápida

Mouse S100A1 natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse S100A1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_011309.3
Tamanho de cDNA:285bp
Descrição de cDNA:Full length Clone DNA of Mus musculus S100 calcium binding protein A1.
Sinónimo de gene:S100, S100a, AI266795, S100a1
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

S100A1 is a Ca2+binding protein of the EF-hand type that belongs to the S100 protein family. S100 proteins consisting of at least 19 members exist as dimers in the cytoplasm and/or nucleus of a wide range of cells, and are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation.This protein has been shown to function in the processes including stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of PKC-mediated phosphorylation.. Phosphoglucomutase is a target protein whose activity is antagonistically regulated by S100A1, and recently, S100A1 is also identified as a potent molecular chaperone and a new member of the Hsp70/Hsp90 multichaperone complex. S100A1 displays a tissue-specific expression pattern with highest levels in myocardium and is considered to be an important regulator of cardiac contractility. Accordingly, reduced expression or mutations of S100A1 gene have been implicated in cardiomyopathies.

Referências
  • Remppis, A .et al., 1996, Biochim. Biophs. Acta. 1313: 253-257.
  • Most, P. et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98: 13889-13894
  • Okada, M. et al., 2004, J. Biol. Chem. 279: 4221-4233.
  • Schafer, W.E. et al., 1995, Genomics. 25: 638-643.
  • Landar, A. et al., 1996, Cell. Calcium. 20: 279-285.
  • Size / Price
    Catálogo: MG50266-UT
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeksInstruções de envio
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"