Encomenda rápida

Ratazanao Raf-1/RAF1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato RAF1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_029780.3
    Tamanho de cDNA:1947bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus v-raf-leukemia viral oncogene 1.
    Sinónimo de gene:Apn, Cd13, Lap-1, Lap1, p150
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RAF1 qPCR primers for gene expression analysis, MP200311 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fundo

    RAF1 gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Size / Price
    Catálogo: MG50287-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"