Encomenda rápida

Ratazanao ROBO4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ROBO4 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_028783.2
    Tamanho de cDNA:3048bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus roundabout homolog 4 (Drosophila) with C terminal His tag.
    Sinónimo de gene:AI593217, 1200012D01Rik, Robo4
    Espécie:Mouse
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ROBO4 qPCR primers for gene expression analysis, MP201039 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fundo

    Roundabout homolog 4, also known as magic roundabout and ROBO4 is a member of the immunoglobulin superfamily and ROBO family. ROBO4 is specifically expressed in endothelial cells. It is expressed at sites of angiogenesis in different tumor types. ROBO4 contains two fibronectin type-III domains and two Ig-like C2-type (immunoglobulin-like) domains. ROBO4 is the fourth identified member of the roundabout receptor family. It is the only Robo family member expressed in primary endothelial cells and that application of Slit inhibits their migration. ROBO4 is predominantly expressed in embryonic or tumor vascular endothelium and is considered important for vascular development and as a candidate tumor endothelial marker. ROBO4 is a bona fide member of the Robo family and may provide a repulsive cue to migrating endothelial cells during vascular development. ROBO4 is a receptor for Slit proteins, at least for SLIT2, and seems to be involved in angiogenesis and vascular patterning. ROBO4 may mediate the inhibition of primary endothelial cell migration by Slit proteins. Activating ROBO4 may have broad therapeutic application in diseases characterized by excessive angiogenesis and/or vascular leak.

    Referências
  • Huminiecki L., et al., 2002, Genomics 79:547-552.
  • Park,K.W. et al., 2003,Dev Biol. 261 (1):251-67.
  • Yoshikawa,M. et al., 2008, Protein Expr Purif. 61 (1):78-82.
  • Jones,C.A. et al., 2008, Nat Med. 14 (4):448-53.
  • Koch,A.W. et al., 2011, Dev Cell. 20 (1):33-46.
  • Size / Price
    Catálogo: MG51081-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"