Encomenda rápida

Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse RNGTT Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1794bp
Descrição de cDNA:Full length Clone DNA of Mus musculus RNA guanylyltransferase and 5'-phosphatase with C terminal His tag.
Sinónimo de gene:AU020997
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG53041-ACG$245
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG53041-ACR$245
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG53041-ANG$245
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG53041-ANR$245
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG53041-CF$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG53041-CH$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG53041-CM$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG53041-CY$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de expressão)MG53041-G$75
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG53041-NF$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG53041-NH$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG53041-NM$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG53041-NY$215
Ratazanao RNGTT clonagem de ADN ou de clonagem do gene (vector de clonagem)MG53041-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG53041-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.