Encomenda rápida

Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato RIPK3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1461bp
Descrição de cDNA:Full length Clone DNA of Mus musculus receptor-interacting serine-threonine kinase 3 with C terminal His tag.
Sinónimo de gene:Rip3, AW107945, 2610528K09Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with RIPK3 qPCR primers for gene expression analysis, MP201024 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51069-ACG$225
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51069-ACR$225
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51069-ANG$225
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51069-ANR$225
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51069-CF$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51069-CH$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51069-CM$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51069-CY$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51069-G$75
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51069-G-N$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51069-NF$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51069-NH$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51069-NM$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51069-NY$195
Ratazanao RIPK3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51069-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51069-CH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.