Encomenda rápida

Ratazanao RhoA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse RHOA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:582bp
Descrição de cDNA:Full length Clone DNA of Mus musculus ras homolog gene family, member A with N terminal Myc tag.
Sinónimo de gene:Arha; Arha1; Arha2
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao RhoA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

  • Kiss C, et al.,1997, Cytogenet. Cell Genet. 79 (3-4): 228-30.
  • Anastasiadis,P.Z. et al., 2000, Nat Cell Biol. 2 (9):637-44.
  • Yiu G, et al.,2006, Nat. Rev. Neurosci. 7 (8): 617-27.
  • Wang,HR. et al., 2006, Methods Enzymol. 406 :437-47.
  • Heo,J. et al., 2006, Biochemistry. 45 (48):14481-9.
  • Size / Price
    Catálogo: MG52590-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.