Encomenda rápida

Ratazanao REG3D clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse REG3D Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_013893.2
Tamanho de cDNA:528bp
Descrição de cDNA:Full length Clone DNA of Mus musculus regenerating islet-derived 3 delta with N terminal HA tag.
Sinónimo de gene:Ingaprp, MGC130575, Reg3d
Espécie:Mouse
Vetor:pCMV3-SP-N-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

Regenerating islet-derived 3 delta (REG3D) is a member of the secreted Reg superfamily and contains one typical C-type lectin domain. Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family, which consists of four subtypes (types I, II, III, IV) based on the primary structures of the encoded proteins of the genes, which are associated with tissue repair and have been directly implicated in pancreatic beta-cell regeneration. Reg proteins are expressed in various organs and are involved in cancers and neurodegenerative diseases. They display a typical C-type lectin-like domain but possess additional highly conserved amino acids.

Referências
  • Laurine E, et al. (2005) PAP IB, a new member of the Reg gene family: cloning, expression, structural properties, and evolution by gene duplication. Biochim Biophys Acta. 1727 (3): 177-87.
  • Hillier LW, et al. (2005) Generation and annotation of the DNA sequences of human chromosomes 2 and 4. Nature 434 (7034): 724-31.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99 (26): 16899-903.
  • Size / Price
    Catálogo: MG50540-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"