Encomenda rápida

Text Size:AAA

Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse RBM10 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2562bp
Descrição de cDNA:Full length Clone DNA of Mus musculus RNA binding motif protein 10 with C terminal His tag.
Sinónimo de gene:E430039K10Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52280-ACG$325
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52280-ACR$325
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52280-ANG$325
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52280-ANR$325
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52280-CF$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52280-CH$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52280-CM$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52280-CY$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52280-G$75
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52280-NF$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52280-NH$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52280-NM$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52280-NY$295
Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52280-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52280-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.