Encomenda rápida

Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato RBM10 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:2562bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus RNA binding motif protein 10 with C terminal His tag.
    Sinónimo de gene:E430039K10Rik
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with RBM10 qPCR primers for gene expression analysis, MP202153 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52280-ACG$325
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52280-ACR$325
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52280-ANG$325
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52280-ANR$325
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52280-CF$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52280-CH$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52280-CM$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52280-CY$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52280-G$75
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52280-NF$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52280-NH$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52280-NM$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52280-NY$295
    Ratazanao RBM10 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52280-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG52280-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.