Encomenda rápida

Ratazanao RAC1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato RAC1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:579bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus RAS-related C3 botulinum substrate 1 with N terminal Myc tag.
    Sinónimo de gene:AL023026, D5Ertd559e, Rac1
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with RAC1 qPCR primers for gene expression analysis, MP200762 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name

    RAC1 is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for RAC1 gene. RAC1 is a plasma membrane-associated small GTPase which cycles between active GTP-bound and inactive GDP-bound states. In its active state, binds to a variety of effector proteins to regulate cellular responses such as secretory processes, phagocytosis of apoptotic cells, epithelial cell polarization and growth-factor induced formation of membrane ruffles. RAC1 p21/rho GDI heterodimer is the active component of the cytosolic factor sigma 1, which is involved in stimulation of the NADPH oxidase activity in macrophage. RAC1 is essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. RAC1's isoform B has an accelerated GEF-independent GDP/GTP exchange and an impaired GTP hydrolysis, which is restored partially by GTPase-activating proteins. It is able to bind to the GTPase-binding domain of PAK but not full-length PAK in a GTP-dependent manner, suggesting that the insertion does not completely abolish effector interaction.

    Stat3 is an important transcription factor that regulates both proinflammatory and anit-apoptotic pathways in the heart. It forms a multiprotein complex with RAC1 and PKC in an H/R-dependent manner by expression of constitutively active Rac1 mutant protein, and by RNA silencing of RAC1. Selective inhibition of PKC with calphostin C produces a marked suppression of Stat3 S727 phosphorylation. The association of Stat3 with Rax1 occurs predominantly at the cell membrane, but also inside the nucleus, and occurs through the binding of the coiled-coil domain of Stat3 to the 54 NH(2)-terminal residues of RAC1. Transfection with a peptide comprising the NH(2)-terminal 17 amino acid residues of RAC1-dependent signaling pathways resulting in physical association between Rac1 and Stat3 and the formation of a novel multiprotein complex with PKC.

  • Kogai T, et al.. (2012) Regulation of sodium iodide symporter gene expression by Rac1/p38β mitogen-activated protein kinase signaling pathway in MCF-7 breast cancer cells. J Biol Chem. 287(5):3292-300.
  • Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.
  • Chang MH, et al. (2012) Prognostic role of integrin β1, E-cadherin, and rac1 expression in small cell lung cancer. APMIS. 120(1):28-38.
  • Osborn-Heaford HL, et al. (2012) Mitochondrial Rac1 GTPase import and electron transfer from cytochrome c are required for pulmonary fibrosis. J Biol Chem. 287(5):3301-12.
  • Mattagajasingh SN, et al. (2012) Activation of Stat3 in endothelial cells following hypoxia-reoxygenation is mediated by Rac1 and protein Kinase C. Biochim Biophys Acta. 1823(5):997-1006.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.