Encomenda rápida

Text Size:AAA

Ratazanao PGLYRP1/PGRP-S clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PGLYRP1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:549bp
Descrição de cDNA:Full length Clone DNA of Mus musculus peptidoglycan recognition protein 1 with N terminal His tag.
Sinónimo de gene:PGRP, Tag7, Tasg7, PGRP-S, Pglyrp, Tnfsf3l
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao PGLYRP1/PGRP-S clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name

Mouse Peptidoglycan recognition protein 1, also known as Peptidoglycan recognition protein short, PGRP-S, PGLYRP1, PGLYRP, PGRP and TNFSF3L, is a secreted protein which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. PGLYRP1 / PGLYRP is highly expressed in bone marrow. It is weakly expressed in kidney, liver, small intestine, spleen, thymus, peripheral leukocyte, lung, fetal spleen and neutrophils. PGLYRP1 / PGLYRP is a pattern receptor that binds to murein peptidoglycans (PGN) of Gram-positive bacteria. It has bactericidal activity towards Gram-positive bacteria. PGLYRP1 / PGLYRP may kill Gram-positive bacteria by interfering with peptidoglycan biosynthesis. It binds also to Gram-negative bacteria, and has bacteriostatic activity towards Gram-negative bacteria.

Peptidoglycan recognition proteins ( PGRPs or PGLYRPs ) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs: PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4. They are secreted proteins expressed in polymorphonuclear leukocytes ( PGLYRP1 ), liver ( PGLYRP2 ), or on body surfaces, mucous membranes, and in secretions (saliva, sweat) (PGLYRP3 and PGLYRP4). All PGRPs recognize bacterial peptidoglycan. The PGRPs likely play a role both in antibacterial defenses and several inflammatory diseases. They modulate local inflammatory responses in tissues (such as arthritic joints) and there is evidence for association of PGRPs with inflammatory diseases, such as psoriasis.

Size / Price
Catálogo: MG50115-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.