After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PRMT6 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_178891.4
Tamanho de cDNA:1137bp
Descrição de cDNA:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 6 with N terminal Flag tag.
Sinónimo de gene:Hrmt1l6, AW124876, BB233495, Prmt6
Espécie:Mouse
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51052-ACG$225
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51052-ACR$225
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51052-ANG$225
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51052-ANR$225
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51052-CF$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51052-CH$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51052-CM$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51052-CY$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51052-G$75
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51052-NF$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51052-NH$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51052-NM$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51052-NY$195
Ratazanao PRMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51052-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

Referências
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Size / Price
    Catálogo: MG51052-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"