Encomenda rápida

Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato PRKRA Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_011871.2
    Tamanho de cDNA:942bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus protein kinase, interferon inducible double stranded RNA dependent activator with N terminal His tag.
    Sinónimo de gene:PRK, RAX, Pact, lear, AV120107
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRKRA qPCR primers for gene expression analysis, MP202410 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52537-ACG$225
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52537-ACR$225
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52537-ANG$225
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52537-ANR$225
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52537-CF$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52537-CH$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52537-CM$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52537-CY$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de expressão)MG52537-G$75
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52537-NF$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52537-NH$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52537-NM$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52537-NY$195
    Ratazanao PRKRA clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52537-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"