After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PRKCI Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_008857.3
Tamanho de cDNA:1788bp
Descrição de cDNA:Full length Clone DNA of Mus musculus protein kinase C, iota with N terminal Myc tag.
Sinónimo de gene:Pkci, Pkcl, Prkcl, AI427505, KIAA4165, PKClambda, mKIAA4165, aPKClambda, 2310021H13Rik, Prkci
Espécie:Mouse
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50788-ACG$245
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50788-ACR$245
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50788-ANG$245
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50788-ANR$245
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50788-CF$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50788-CH$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50788-CM$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50788-CY$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de expressão)MG50788-G$75
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50788-NF$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50788-NH$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50788-NM$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50788-NY$215
Ratazanao PKC iota clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50788-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.

Referências
  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"