After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PREP Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_011156.2
Tamanho de cDNA:2133bp
Descrição de cDNA:Full length Clone DNA of Mus musculus prolyl endopeptidase.
Sinónimo de gene:PEP, AI047692
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50288-ACG$245
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50288-ACR$245
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50288-ANG$245
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50288-ANR$245
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50288-CF$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50288-CH$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50288-CM$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50288-CY$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de expressão)MG50288-M$75
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50288-NF$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50288-NH$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50288-NM$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50288-NY$215
Ratazanao Prolyl endopeptidase / PREP clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50288-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

Referências
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Catálogo: MG50288-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"