Encomenda rápida

Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PPM1A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1149bp
Descrição de cDNA:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal His tag.
Sinónimo de gene:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50277-ACG$225
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50277-ACR$225
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50277-ANG$225
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50277-ANR$225
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50277-CF$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50277-CH$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50277-CM$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50277-CY$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de expressão)MG50277-M$75
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50277-NF$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50277-NH$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50277-NM$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50277-NY$195
Ratazanao PPM1A/PP2CA clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50277-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Catálogo: MG50277-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.