Encomenda rápida

Ratazanao Periostin/POSTN/OSF-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato POSTN Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2436bp
Descrição de cDNA:Full length Clone DNA of Mus musculus periostin, osteoblast specific factor with C terminal His tag.
Sinónimo de gene:PN, Osf2, peri, OSF-2, AI747096, Periostin
Local de restrição:KpnI (two restriction sites) + XbaI (6kb + 1.78kb + 0.71kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 453T/A, 1452T/C, 1476A/G, 1902T/C, 2220T/C  not causing the amino acid variation.
( We provide with POSTN qPCR primers for gene expression analysis, MP200090 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Rato POSTN Gene Plasmid Map
Mouse POSTN ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao Periostin/POSTN/OSF-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Catálogo: MG50450-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    • Mouse POSTN ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.