Encomenda rápida

Text Size:AAA

Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PLA2G4A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2247bp
Descrição de cDNA:Full length Clone DNA of Mus musculus phospholipase A2, group IVA (cytosolic, calcium-dependent) with C terminal His tag.
Sinónimo de gene:cPLA2, Pla2g4, cPLA2alpha
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51714-ACG$245
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51714-ACR$245
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51714-ANG$245
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51714-ANR$245
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51714-CF$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51714-CH$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51714-CM$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51714-CY$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de expressão)MG51714-G$75
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51714-NF$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51714-NH$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51714-NM$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51714-NY$215
Ratazanao PLA2G4A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51714-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51714-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.