After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PRKCD Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2025bp
Descrição de cDNA:Full length Clone DNA of Mus musculus protein kinase C, delta with C terminal Myc tag.
Sinónimo de gene:Pkcd, PKC[d], AI385711, PKCdelta, D14Ertd420e, Prkcd
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50345-ACG$245
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50345-ACR$245
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50345-ANG$245
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50345-ANR$245
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50345-CF$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50345-CH$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50345-CM$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50345-CY$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de expressão)MG50345-M$75
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50345-NF$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50345-NH$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50345-NM$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50345-NY$215
Ratazanao PRKCD clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50345-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Size / Price
    Catálogo: MG50345-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.