Encomenda rápida

Text Size:AAA

Mouse PHGDH ORF mammalian expression plasmid, C-HA tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PHGDH Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1602bp
Descrição de cDNA:Full length Clone DNA of Mus musculus 3-phosphoglycerate dehydrogenase with C terminal HA tag.
Sinónimo de gene:A10; PGD; PGAD; PGDH; SERA; 3PGDH; 3-PGDH; 4930479N23
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

PHGDH is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. This new family consists of D-isomer-stereospecific enzymes. The conserved residues in this family appear to be the residues involved in the substrate binding and the catalytic reaction, and thus to be targets for site-directed mutagenesis. A number of NAD-dependent 2-hydroxyacid dehydrogenases which seem to be specific for the D-isomer of their substrate have been shown to be functionally and structurally related. PHGDH catalyzes the transition of 3-phosphoglycerate into 3-phosphohydroxypyruvate, which is the first and rate-limiting step in the phosphorylated pathway of serine biosynthesis, using NAD+/NADH as a cofactor. Overexpression of PHGDH may cause certain breast cancers. Defects in PHGDH are the cause of phosphoglycerate dehydrogenase deficiency which is characterized by congenital microcephaly, psychomotor retardation, and seizures.

  • Pind S, et al. (2002) V490M, a common mutation in 3-phosphoglycerate dehydrogenase deficiency, causes enzyme deficiency by decreasing the yield of mature enzyme. J Biol Chem. 277 (9): 7136-43.
  • Du H, et al. (2010) 3-Phosphoglycerate dehydrogenase expression is regulated by HOXA10 in murine endometrium and human endometrial cells. Reproduction. 139 (1): 237-45.
  • Possemato R, et al. (2011) Functional genomics reveal that the serine synthesis pathway is essential in breast cancer. Nature. 476 (7360): 346-50.
  • Size / Price
    Catálogo: MG51754-CY
    Preço de catálogo:   (Save )
    Preço:      [How to order]
     Instruções de envio
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.