After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PFN2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_019410.3
Tamanho de cDNA:423bp
Descrição de cDNA:Full length Clone DNA of Mus musculus profilin 2 with C terminal Myc tag.
Sinónimo de gene:Pfn
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51608-ACG$225
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51608-ACR$225
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51608-ANG$225
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51608-ANR$225
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51608-CF$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51608-CH$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51608-CM$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51608-CY$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51608-NF$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51608-NH$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51608-NM$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51608-NY$195
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51608-U$75
Ratazanao Profilin 2 / PFN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51608-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Profilin 2, also known as PFN2, is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thought to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

Referências
  • Da Silva. et al., 2003, J Cell Biol. 162 (7): 1267-79.
  • Honore B. et al., 1993, FEBS Lett. 330 (2): 151-5.
  • Joensuu T. et al., 1997, Genomics. 38 (3): 255-63.
  • Size / Price
    Catálogo: MG51608-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"