Encomenda rápida

Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PFKM Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2343bp
Descrição de cDNA:Full length Clone DNA of Mus musculus phosphofructokinase, muscle with N terminal His tag.
Sinónimo de gene:Pfk4, Pfka, Pfkx, PFK-A, PFK-M, Pfk-4, AI131669
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52541-ACG$245
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52541-ACR$245
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52541-ANG$245
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52541-ANR$245
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52541-CF$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52541-CH$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52541-CM$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52541-CY$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de expressão)MG52541-G$75
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52541-NF$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52541-NH$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52541-NM$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52541-NY$215
Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52541-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Catálogo: MG52541-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.