Encomenda rápida

Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato PFKM Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001163487.1
    Tamanho de cDNA:2343bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus phosphofructokinase, muscle with N terminal His tag.
    Sinónimo de gene:Pfk4, Pfka, Pfkx, PFK-A, PFK-M, Pfk-4, AI131669
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PFKM qPCR primers for gene expression analysis, MP202414 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52541-ACG$245
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52541-ACR$245
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52541-ANG$245
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52541-ANR$245
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52541-CF$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52541-CH$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52541-CM$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52541-CY$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de expressão)MG52541-G$75
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52541-NF$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52541-NH$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52541-NM$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52541-NY$215
    Ratazanao PFK1/PFKM clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52541-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

    Size / Price
    Catálogo: MG52541-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"