Encomenda rápida

Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato PELO Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_134058.3
    Tamanho de cDNA:1158bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus pelota homolog (Drosophila).
    Sinónimo de gene:AA409897, AI852218
    Espécie:Mouse
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PELO qPCR primers for gene expression analysis, MP202339 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52466-ACG$225
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52466-ACR$225
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52466-ANG$225
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52466-ANR$225
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52466-CF$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52466-CH$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52466-CM$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52466-CY$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de expressão)MG52466-G$75
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52466-NF$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52466-NH$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52466-NM$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52466-NY$195
    Ratazanao PELO/pelota homolog clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52466-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG52466-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"