After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Mouse PDPN natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PDPN Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010329.2
Tamanho de cDNA:519bp
Descrição de cDNA:Full length Clone DNA of Mus musculus podoplanin.
Sinónimo de gene:T1a, Gp38, OTS-8, PA2.26, T1alpha, RANDAM-2, Pdpn
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.

Referências
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • Size / Price
    Catálogo: MG50256-UT
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade
     Instruções de envio
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"