Encomenda rápida

Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato PDE4B Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001177980.1
    Tamanho de cDNA:1695bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal His tag.
    Sinónimo de gene:Dpde4; dunce; R74983
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PDE4B qPCR primers for gene expression analysis, MP201838 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51965-ACG$245
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51965-ACR$245
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51965-ANG$245
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51965-ANR$245
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51965-CF$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51965-CH$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51965-CM$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51965-CY$215
    Mouse PDE4B Gene cDNA clone plasmidMG51965-G$75
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51965-NF$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51965-NH$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51965-NM$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51965-NY$215
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de expressão)MG51965-U$75
    Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51965-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

    Referências
  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Catálogo: MG51965-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"