After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse PDE4B Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001177980.1
Tamanho de cDNA:1695bp
Descrição de cDNA:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal His tag.
Sinónimo de gene:Dpde4; dunce; R74983
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51965-ACG$245
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51965-ACR$245
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51965-ANG$245
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51965-ANR$245
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51965-CF$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51965-CH$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51965-CM$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51965-CY$215
Mouse PDE4B Gene cDNA clone plasmidMG51965-G$75
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51965-NF$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51965-NH$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51965-NM$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51965-NY$215
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de expressão)MG51965-U$75
Ratazanao PDE4B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51965-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

Referências
  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Catálogo: MG51965-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"