After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao OBCAM/OPCML clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse OPCML Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_177906.4
Tamanho de cDNA:1014bp
Descrição de cDNA:Full length Clone DNA of Mus musculus opioid binding protein/cell adhesion molecule-like with N terminal Flag tag.
Sinónimo de gene:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
Espécie:Mouse
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fundo

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

Referências
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Catálogo: MG51073-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"