Encomenda rápida

Ratazanao NTF5/Neurotrophin-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato NTF4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:630bp
Descrição de cDNA:Full length Clone DNA of Mus musculus neurotrophin 5 with C terminal His tag.
Sinónimo de gene:NT4, NT-4, Ntf4, NT4/5, Ntf-5, AI462899, 2900040K06Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao NTF5/Neurotrophin-4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: MG50456-CH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.